Part:BBa_K1608003:Design
SRPK-His/pSB1C3
- 10INCOMPATIBLE WITH RFC[10]Illegal XbaI site found at 97
Illegal PstI site found at 926
Illegal PstI site found at 977 - 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 926
Illegal PstI site found at 977
Illegal NotI site found at 2221 - 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 189
Illegal BglII site found at 450
Illegal XhoI site found at 1910
Illegal XhoI site found at 2230 - 23INCOMPATIBLE WITH RFC[23]Illegal XbaI site found at 97
Illegal PstI site found at 926
Illegal PstI site found at 977 - 25INCOMPATIBLE WITH RFC[25]Illegal XbaI site found at 97
Illegal PstI site found at 926
Illegal PstI site found at 977 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 2084
Design Notes
- One XbaI site and two PstI sites on the PCR-amplified fragment. To be used as a standard BioBrick part, the sites need to be mutated. Or you can just use EcoRI and SpeI to move this part.
We designed two primers to amplify Pt7-SRPK1-His DNA fragment by PCR from SRPK/pET-29b, followed by EcoRI and SpeI digestion and ligated to pSB1C3. The plasmid DNA has been checked by colony PCR, restriction enzyme check and sequencing confirmation. However, there’re two PstI sites one XbaI site on the amplified sequence. We’re trying to mutate them to fit the standard biobrick parts. The SRPK1 gene is fused with 6XHis tag and driven by Pt7 promoter along with a lac operator downstream.
Primers:
- 1.Pt7(pET)-EcoRI-XbaI-F: 5'- AAAAAAGAATTCGCGGCCGCTTCTAGAGCACGATGCGTCCGGCGTA -3'
- 2.His (pET)-SpeI-R: 5'- AGGGAAACTAGTATCAGTGGTGGTGGTGGTGGT -3'
PCR product size: ~2294 bp
Plasmid map:
For more DNA gel data & sequencing data, please go to our [http://2015.igem.org/Team:Mingdao/Parts page]
Source
The fragment was cloned from SRPK/pET-29b.
References
A human importin-beta family protein, transportin-SR2, interacts with the phosphorylated RS domain of SR proteins. [http://www.ncbi.nlm.nih.gov/pubmed/10713112 J Biol Chem. 2000]